Clone FMO10294 Report

Search the DGRC for FMO10294

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:102
Well:94
Vector:pMK33-CFH-BD
Associated Gene/TranscriptSuUR-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10294.5prime Sequence

1023 bp (668 high quality bases) assembled on 2010-11-11

> FMO10294.5prime
CAGTCGACATGTATCACTTTGTATCCGAGCAAACGCCGGAGGTGCGGCTC
ACAGATGAGGCACTGGTCACGAGCCACGTGACGCAGTACCTCAAGAGCTT
TCAACTGGATGCCGTCCGCTTCGTCTACGATCGTTTGGCTAAGCGGGAAT
TCTGCATCCTGAATGATGAGAGTGGCCTTGGAAAGGTCGCTACGGTGGCG
GCACTTCTAAGTGCCCTACCACCCGCCAAAAAAACACTTGTGGTGCTCCA
GAACGATGAGCAACTGCTCACCGGTTGGCGATTCCATTTGGACACTCTCA
CTGACCTCCAGGTGTACATCATTCAGGGGGTGCAAGATACCACCGACTCC
CCGCACAGCGTTTACCTGGCGAAATGGAGCCAACTACGGAGCATTGGAGA
TCTCAGTCGCCTCAAGTTCGACTACATTATGGTGGATAATCGGGGGCATT
CGCCGACCAACAGCTTTTGCACTTCCATGCTGCTGAAGCAATTCGAGGGA
CGGGTAAACGTTCTTATCTCCAGTGTTGACGTTACGTCCGACGTTAGGTT
GCTCTACAATGTTCTACGGTTGGGCGGCCGACTGGAGCATCAGTACAAAA
GCTTTGCCACCTACCATCTTAAAATTCCATCTGCCAGATCCGAAGGAGGT
ATTCAGTAAGCGCCCCCCCCCCCCCAGATTATATTTATTTATCGGGGATT
CCTCAGCGAGTACATCAAGGACTTTCGTCTGCGTCGTTTTCGTCATCAAT
TCGACAAGTCACTGCCACTTGCCCCCATTTTATTTATATAAACACAATCT
GAATCTCTGGTTGGCCTCAAAGAACAGCCAGAGCACAATAAGCGGCTCAG
ATGTGTGCTCTACAATCGCTTCCATAGACAACACTCCCGGCCCAGAAAAA
AAAAACAGAACTCCTCCGAAGAACGGATAGGTATCCGAGCACAGCGTGGA
TGATGTGGCCATGTCACCGCTGATATTCGAGTATTCCGAGTCTGACGATG
ACCCCCCTACCAGTAGAACTTGA

FMO10294.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:01:44
Subject Length Description Subject Range Query Range Score Percent Strand
SuUR-RA 3776 CG7869-RA 404..1414 8..1023 4145 94.4 Plus
CG45101-RA 3776 CG45101-RA 404..1414 8..1023 4145 94.4 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:01:42
Subject Length Description Subject Range Query Range Score Percent Strand
3L 28110227 3L 11065394..11065722 8..336 1645 100 Plus
3L 28110227 3L 11065828..11066029 335..536 980 99 Plus
3L 28110227 3L 11066361..11066663 719..1023 925 89.9 Plus
3L 28110227 3L 11066095..11066221 536..663 515 95.3 Plus
Blast to na_te.dros performed on 2014-11-26 17:01:43 has no hits.

FMO10294.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:14:21 Download gff for FMO10294.5prime
Subject Subject Range Query Range Percent Splice Strand
SuUR-RA 392..1407 1..1022 94   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:14:38 Download gff for FMO10294.5prime
Subject Subject Range Query Range Percent Splice Strand
SuUR-RA 398..1413 1..1022 94   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:44:35 Download gff for FMO10294.5prime
Subject Subject Range Query Range Percent Splice Strand
CG45101-RA 398..1413 1..1022 94   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:44:35 Download gff for FMO10294.5prime
Subject Subject Range Query Range Percent Splice Strand
3L 11065830..11066029 337..536 99 -> Plus
3L 11065388..11065722 1..336 98 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:14:38 Download gff for FMO10294.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_3L 11058930..11059129 337..536 99 -> Plus
arm_3L 11058488..11058822 1..336 98 -> Plus