Clone FMO10301 Report

Search the DGRC for FMO10301

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:103
Well:1
Vector:pMK33-CFH-BD
Associated Gene/TranscriptCG31682-RA
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10301.5prime Sequence

663 bp (663 high quality bases) assembled on 2010-11-12

> FMO10301.5prime
CAGTCGACATGGAAGCGCCGGTGAAGGGCATTATTGGTATTCTGGCCACT
GCTGGATCGTTTTTTGCACTAGGAGCTTACTATCAGCACATCGATGTCAT
GCGAAAGATTCGACGATTGGAGCAACGAAACCCACATGCCTACTTTATCA
GAAGGAAACTGTACGCACTGCTGGGAATTTTCGCTGTGCGCCCTGATAAC
TCAGAATTCGACGTGGATACCGATGACTGCCACAAGCTGGGCGGGATCAT
GAAGTACGGCTTCCCCAGCACCAATGATATCACCATAAATGAGACCTTTG
ACTTTGTGACCTCTTTCGATCGAAGAAACTCTGCGATTCTGTGGATGTGC
GAGCGGGTAGATCTGTCCAATCGCGTCGTCTACGGGGATTCCACATCCGT
GGCTCCAGCTGGAGCATTTGGACAGTCGGAGGCAGCCAGGGTATTTTTCC
TGTCCAACATTAGGCCCTTTCTAAACAGAGGGTTCAATCTCACTGTCTGG
GATCGACTGCTGCAGTACGTCCATGAGATGAGTCAACGACATGGAACCGT
GTATGCCTACACCGGATCAATTTACTTGCCCCGGGAGCTAAAGTCGAACA
GTTGGTTCCTGGAGTTCCAGTCGGAGGAGAGAACCATGGTGGCCGTACCC
ACCCATTTCTTCA

FMO10301.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:10:13
Subject Length Description Subject Range Query Range Score Percent Strand
Tengl1-RA 1108 CG31682-RA 92..746 9..663 3275 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:10:11
Subject Length Description Subject Range Query Range Score Percent Strand
2L 23513712 2L 2239776..2240269 663..170 2470 100 Minus
2L 23513712 2L 2240341..2240502 170..9 810 100 Minus
Blast to na_te.dros performed on 2014-11-26 17:10:12 has no hits.

FMO10301.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:16:00 Download gff for FMO10301.5prime
Subject Subject Range Query Range Percent Splice Strand
CG31682-RA 87..745 1..662 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:20:53 Download gff for FMO10301.5prime
Subject Subject Range Query Range Percent Splice Strand
Tengl1-RA 87..745 1..662 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:49:57 Download gff for FMO10301.5prime
Subject Subject Range Query Range Percent Splice Strand
Tengl1-RA 87..745 1..662 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:49:57 Download gff for FMO10301.5prime
Subject Subject Range Query Range Percent Splice Strand
2L 2240341..2240506 1..170 97   Minus
2L 2239777..2240268 171..662 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:20:53 Download gff for FMO10301.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_2L 2240341..2240506 1..170 97   Minus
arm_2L 2239777..2240268 171..662 100 <- Minus