Clone FMO10304 Report

Search the DGRC for FMO10304

Clone and Library Details

Library:FMO
Tissue Source:D. melanogaster
Created by:Charles Yu
Date Registered:2006-03-07
Comments:BD Creator expression clones with C-terminus FLAG HA tag for tissue culture
Original Plate Number:103
Well:4
Vector:pMK33-CFH-BD
Associated Gene/Transcript
Protein status:
Sequenced Size:Not sequenced

Clone Sequence Records

FMO10304.5prime Sequence

824 bp (824 high quality bases) assembled on 2010-11-12

> FMO10304.5prime
CAGTCGACATGCGCATGCTTTTTATGATTTTCACAATAGCCGAGCGAAGT
TTCAAGATTCTAGAACTACCCACCACACCAACGCTTCTGCTGCGCCGCCA
GTCCCACAACTACGGCTACGACTACATCAGCCCCACGCACATCGAACTCA
GCCGGGAAGCAACTCGCCTGGTAATTCGCCGTCTGCAGCGCACCGTTCTC
CGCCTGATCCGTGACCCGGACTTCATCATGTCTGCCGAGGCGAATCCCGA
GATGGATAAGGAGCACCACGAGTCCCCATTCGCAGCGAACCGCAAGGCCG
GTGCCAGCGGCGCCGGCAAACAGGACTCGAACTGCCGCACCTGCAACGAT
TTCAAGTCGTGGTCCAAGCAGCAACGCCTCATCTCCAACGTGCAGAGCGC
CAAGGTGAAGCACATGGCCGCCGCCGAAAAGCTGACCGTCAACGCCGCCG
AAGATCCGCTGCCCCGCGACGACTGCCCGCTGGACAAGGTGAGGCTGGGA
ATTTCCACCTGGGGACTGCTCCACACCATGGCCGCCTTTTACTCGGACAA
CCCCACGGACACCGAGAAGCGCGACATGAAGACCTTTTTTGAGGTTCTGT
CGCGCCTTTACCCCTGCGAGTTTTGCGCCAAGGACTTTCGCACCGACCTG
GACGTCAACCCCATCAATGTGAACTCCCAAAAGGAGCTAGCACTGTGGCT
GTGCAAGTTCCACAACCGAGTGAACGACAAACTGGGCAAACCGCTCTTCG
ATTGCACCAAGGTGAACGAGAGGTGGCGCGACGGCTGGCTAGACGGCTCC
TGCGACGCAAGCTTTCTAGACCAT

FMO10304.5prime Blast Records

Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:10:23
Subject Length Description Subject Range Query Range Score Percent Strand
Alr-RB 1362 CG12534-RB 245..1043 8..806 3995 100 Plus
Alr-RA 1107 CG12534-RA 1..788 19..806 3940 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-26 17:10:21
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 19748912..19749312 8..408 2005 100 Plus
X 23542271 X 19749386..19749629 403..646 1220 100 Plus
X 23542271 X 19749689..19749848 647..806 800 100 Plus
Blast to na_te.dros performed on 2014-11-26 17:10:22 has no hits.

FMO10304.5prime Sim4 Records

Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-11-15 11:16:01 Download gff for FMO10304.5prime
Subject Subject Range Query Range Percent Splice Strand
CG12534-RA 1..797 15..812 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 01:21:00 Download gff for FMO10304.5prime
Subject Subject Range Query Range Percent Splice Strand
Alr-RB 171..978 1..812 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-26 17:50:03 Download gff for FMO10304.5prime
Subject Subject Range Query Range Percent Splice Strand
Alr-RB 241..1048 1..812 99   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-26 17:50:03 Download gff for FMO10304.5prime
Subject Subject Range Query Range Percent Splice Strand
X 19749689..19749853 647..812 98   Plus
X 19749388..19749629 405..646 100 -> Plus
X 19748908..19749308 1..404 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 01:21:00 Download gff for FMO10304.5prime
Subject Subject Range Query Range Percent Splice Strand
arm_X 19643722..19643886 647..812 98   Plus
arm_X 19643421..19643662 405..646 100 -> Plus
arm_X 19642941..19643341 1..404 99 -> Plus