Clone GH14260 Report

Search the DGRC for GH14260

Clone and Library Details

Library:GH
Tissue Source:Drosophila melanogaster head
Created by:Ling Hong
Date Registered:1998-06-02
Comments:Sized fractionated cDNAs were directly ligated into pOT2. Plasmid cDNA library.
Original Plate Number:142
Well:60
Vector:pOT2
Associated Gene/TranscriptCG9775-RD
Protein status:GH14260.pep: gold
Preliminary Size:2403
Sequenced Size:2431

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG9775 2001-01-01 Release 2 assignment
CG9775 2001-11-09 Blastp of sequenced clone
CG9775 2008-04-29 Release 5.5 accounting
CG9775 2008-08-15 Release 5.9 accounting
CG9775 2008-12-18 5.12 accounting

Clone Sequence Records

GH14260.complete Sequence

2431 bp (2431 high quality bases) assembled on 2001-11-09

GenBank Submission: AY069133

> GH14260.complete
AACAATGCCTGATTTTTTTGTCAGCCTGAAAAGCAGCGAGGAAAAACTTG
AATTTCGTCTGTAAAACATATCTAATCGGAACCAAGCCACTGAAAAAGTC
GTAGTTTAGGCTAAATAAACGAGAAATCAACGAGTGAAACTAATTTCTAT
CTGTGGACAGAACGCCCCCGCACCTATTTTTGTGCTGAGGAACAAGCGAA
GCAGCGACGCACAATTCAGAAATTTGCAAACCGGTTTTCGGCGCAGAAAC
ACCCACTCGATCGTCCAAGAGTCAAGCGGAGAACAGTGAAAACATACATT
ATAAGGATCAATTTATAAAAGCAAAGCCGCAACAATCATGAACACTGGAA
TCTCCTTAAACGAGCGCTTTACGCAGATGCAGTCAAAGCAGCCGCCACAG
GGACGCGGTCGCAGCCGCTCCAGGAGCAGGAGTCGCCGCATTGTGAGCAG
CGGAGCCGGAAATCAAGGAATGTCCGCGGTCAACTCTAGGCTGCTGAATG
AATTCAAGAGGCTCCACACCGTTCAGACGGCCCTCAAACTGAAGCGCGTA
CGTGTTTCCTAAAAACCGAATAATGCAACCAGGCATCGGAAAGCGACCTG
ATCCGTAGGACAGGTTTATGTCTGACAGGCTTGGATTACCCGGAGGAGAG
GGGTCGGACTATGCTGTCGAGAAAAGTGCGCCTTCTGCGTGGTACATAAA
AACCCTACAGACTCTCAGACTCTCTCTCTATCCCTTGATCTTGAACTCCA
ACACTGCAGCAGCGTACTGACACCAAAACTTCCACACAACCTTATGCCTC
CTTACAGAGAAGCTTACGGACCACCGCAGTCAGCGGTCGTGGACCACGCG
TCGCCGGCGTCAAGTCGCTGCGACTGGCGCCCAACGGGAAGCCCATACGG
TCCAACAACGTGACCAGGGTAGCAACGTAAGCATCTTGCCTATAATCGCG
CTCAACTATCAATCCACTGCAACATCTCTGTACTTCTTCGTTAATCGCTC
AGGATGCGTGCCGATCTAGTGGCAAGCGGCAATGCCGCACGCAATCGCCG
CAGCGGCAGCAGCATGCGCAATGTCCCCGCCACTAACGGTGGTGGAGGCG
GACTTCGGCAGCGGCTAGGACAGCGCCGCCCTTCTGTGGGCGGTGCCGCC
GAGCGCGTTGAGCGTCGTCAGCGACAGCAGCAGCAAGCCCCACGAGGACG
TTCCCGCTCTCAGTCCCGTTCGCGCCACCCGCAAATACAGCGTGTGGACA
GAGCACGTTCCCAAAGCCGTGGACGCAGCATTGGGCGTTCCCAGAGCCGC
AATCGCGATCGCTCCGCCCAGGGCCGAGTTCCAGTGAAACAGCGGCTTTC
AGTCAAGCACCGCCTTGGCGTGCGAACCGGCCAGAGAAACAACCAGGCCA
AGATCCCACCGCAGCGCCGGGCACCAAGCCAAATTCGAGGTGTGGCAGGC
GGACGGGTCGAGAAGCGTCGTAGTGCTCAGATTTCCCAAAAGAAGGGAGT
TTCCGCCTCGATTGCCGGACGTCAAGGACGACCACGTAGAAGATCTGTTG
CAAGAAACGCTGCTTCTAGCAGTGGGGCAGTTAACAATTCTGCTTCTGCT
CGTCGCTCACGCTCGCGCAATCGTGCTGCCGCCGTCGCTGCTGCCGCTAT
CGCCGCTACTGTTCAGGGCCGGGCTAATCCTCGCCAGAGACGCGGACGCA
GTGCAGGCGCTGCCAAGGGCAAGATCATCAGAAATGGTAAAGCTGACAAA
AACGCGAAGGTCAAGGCGACAAACGGTGTCAAAAGTGGCCCGCAGCAACA
GGTTCGACGGGGACGCAGTCGTAGTCGTAAGCCTACAGGTAAAAGCGAGA
CAAGTGGCCAGGAGACAAACCGGACTGGATCTGGAAATAGGCACTTGAAA
CTCAAAATTGACATATTTTTGTCTCTACTTTCTACTTACACTCTTGATTA
ACATGTTTTCTCTGTTTAATAGGCAAACCACAGCGTCCAGAGGTTAAGCG
CGAGGATCTTGACATGGAACTGGATCAGTATATGTCCACCACTAAGTCGG
AGATGGACTACTTGCTGAAGTAAACACAAGTAGATTGGACCACAAACTAT
TGAATTAAAAACAATTGAATGAACAGAATGTAACAACCACCGGCTATAGG
CAGATGTTTCTCTCGTTGCACTAAGTTACCGCCTAGTTTTAAAATATTTC
TAAGTTTTAAACCATGTTAAAAGCGTCCAAAAAGAGCGCTTAGGCATAGA
GATGTTCTCGTGTATATATGGCAAGTTCTAATATAATAAGTAAATATGGT
CGAGAATTGTATAGTTCATGAATGATATTGTTAATCGCAATTCCGAAATA
CAAACTATTCATTGCTCAACTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

GH14260.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 20:00:17
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-RD 2552 CG9775-RD 76..2450 1..2375 11875 100 Plus
CG9775-RA 2108 CG9775-RA 768..1608 1003..1843 4190 99.8 Plus
CG9775-RC 1749 CG9775-RC 513..1353 1003..1843 4190 99.8 Plus
CG9775-RA 2108 CG9775-RA 102..648 1..547 2735 100 Plus
CG9775-RA 2108 CG9775-RA 1602..2006 1971..2375 2025 100 Plus
CG9775-RC 1749 CG9775-RC 1347..1749 1971..2373 2015 100 Plus
CG9775-RC 1749 CG9775-RC 67..393 221..547 1635 100 Plus
CG9775-RA 2108 CG9775-RA 649..768 808..927 600 100 Plus
CG9775-RC 1749 CG9775-RC 394..513 808..927 600 100 Plus
Blast to d_melanogaster_OreR.fa performed 2014-11-27 02:14:51
Subject Length Description Subject Range Query Range Score Percent Strand
chr3R 27901430 chr3R 464728..466046 1542..224 6595 100 Minus
chr3R 27901430 chr3R 463720..464551 2372..1541 4160 100 Minus
chr3R 27901430 chr3R 467039..467261 223..1 1115 100 Minus
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 02:14:46
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-RD 948 CG9775-PD 1..948 1004..1951 4740 100 Plus
CG9775-RE 1266 CG9775-PE 330..1170 1003..1843 4190 99.9 Plus
CG9775-RC 1266 CG9775-PC 330..1170 1003..1843 4190 99.9 Plus
CG9775-RE 1266 CG9775-PE 1..210 338..547 1050 100 Plus
CG9775-RE 1266 CG9775-PE 211..330 808..927 600 100 Plus
CG9775-RE 1266 CG9775-PE 1164..1266 1971..2073 515 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 16:51:13 has no hits.
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 02:14:45
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-RD 2400 CG9775-RD 29..2400 1..2372 11860 100 Plus
CG9775-RE 1966 CG9775-RE 731..1571 1003..1843 4190 99.9 Plus
CG9775-RC 1740 CG9775-RC 505..1345 1003..1843 4190 99.9 Plus
CG9775-RE 1966 CG9775-RE 65..611 1..547 2735 100 Plus
CG9775-RE 1966 CG9775-RE 1565..1966 1971..2372 2010 100 Plus
CG9775-RE 1966 CG9775-RE 612..731 808..927 600 100 Plus
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 02:14:49
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-PD 315 CG9775-PD 1..315 1004..1948 876 100 Plus
CG9775-PE 421 CG9775-PE 111..392 1004..1849 702 99.3 Plus
CG9775-PC 421 CG9775-PC 111..392 1004..1849 702 99.3 Plus
CG9775-PA 421 CG9775-PA 111..392 1004..1849 702 99.3 Plus
CG9775-PE 421 CG9775-PE 1..70 338..547 243 100 Plus
CG9775-PC 421 CG9775-PC 1..70 338..547 243 100 Plus
CG9775-PA 421 CG9775-PA 1..70 338..547 243 100 Plus
CG9775-PE 421 CG9775-PE 70..110 805..927 197 97.6 Plus
CG9775-PC 421 CG9775-PC 70..110 805..927 197 97.6 Plus
CG9775-PA 421 CG9775-PA 70..110 805..927 197 97.6 Plus
CG9775-PE 421 CG9775-PE 389..421 1972..2070 171 100 Plus
CG9775-PC 421 CG9775-PC 389..421 1972..2070 171 100 Plus
CG9775-PA 421 CG9775-PA 389..421 1972..2070 171 100 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 02:14:43
Subject Length Description Subject Range Query Range Score Percent Strand
3R 32079331 3R 4639018..4640336 1542..224 6595 100 Minus
3R 32079331 3R 4638007..4638841 2375..1541 4175 100 Minus
3R 32079331 3R 4641329..4641551 223..1 1115 100 Minus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 21:25:10
Subject Length Description Subject Range Query Range Score Percent Strand
3R 31820162 3R 4379849..4381167 1542..224 6595 100 Minus
3R 31820162 3R 4378838..4379672 2375..1541 4175 100 Minus
3R 31820162 3R 4382160..4382382 223..1 1115 100 Minus
Blast to na_te.dros performed on 2014-11-27 02:14:44 has no hits.

GH14260.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2014-11-27 04:51:00 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
chr3R 467039..467261 1..223 100   Minus
chr3R 464728..466046 224..1542 100 <- Minus
chr3R 463720..464549 1543..2372 100 <- Minus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2008-12-08 16:42:07 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RC 325..1170 997..1843 99 == Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 19:33:25 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 1..948 1004..1951 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 07:11:36 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 1..948 1004..1951 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 20:01:00 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RC 325..1170 997..1843 99 == Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 04:51:00 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 1..948 1004..1951 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2008-11-10 23:12:30 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RA 1..547 1..547 100 == Plus
CG9775-RA 662..1507 997..1843 99 == Plus
CG9775-RA 1508..1902 1978..2372 100   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 19:33:25 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 45..2416 1..2372 100   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 07:11:36 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 29..2400 1..2372 100   Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 20:01:00 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RC 459..1304 997..1843 99 == Plus
CG9775-RC 1305..1699 1978..2372 100   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 04:51:00 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
CG9775-RD 29..2400 1..2372 100   Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 04:51:00 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
3R 4641329..4641551 1..223 100   Minus
3R 4639018..4640336 224..1542 100 <- Minus
3R 4638010..4638839 1543..2372 100 <- Minus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 07:11:36 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
arm_3R 467051..467273 1..223 100   Minus
arm_3R 464740..466058 224..1542 100 <- Minus
arm_3R 463732..464561 1543..2372 100 <- Minus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 16:37:49 Download gff for GH14260.complete
Subject Subject Range Query Range Percent Splice Strand
3R 4382160..4382382 1..223 100   Minus
3R 4379849..4381167 224..1542 100 <- Minus
3R 4378841..4379670 1543..2372 100 <- Minus

GH14260.pep Sequence

Translation from 1003 to 1950

> GH14260.pep
MRADLVASGNAARNRRSGSSMRNVPATNGGGGGLRQRLGQRRPSVGGAAE
RVERRQRQQQQAPRGRSRSQSRSRHPQIQRVDRARSQSRGRSIGRSQSRN
RDRSAQGRVPVKQRLSVKHRLGVRTGQRNNQAKIPPQRRAPSQIRGVAGG
RVEKRRSAQISQKKGVSASIAGRQGRPRRRSVARNAASSSGAVNNSASAR
RSRSRNRAAAVAAAAIAATVQGRANPRQRRGRSAGAAKGKIIRNGKADKN
AKVKATNGVKSGPQQQVRRGRSRSRKPTGKSETSGQETNRTGSGNRHLKL
KIDIFLSLLSTYTLD*

GH14260.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2014-11-27 11:47:25
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF18351-PA 426 GF18351-PA 113..344 1..237 424 65.4 Plus
Blast to dere-all-translation-r1.3.fasta performed 2014-11-27 11:47:26
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG11466-PA 423 GG11466-PA 111..422 1..314 873 78.3 Plus
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 11:47:23
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-PD 315 CG9775-PD 1..315 1..315 1552 100 Plus
CG9775-PE 421 CG9775-PE 111..392 1..282 1378 99.3 Plus
CG9775-PC 421 CG9775-PC 111..392 1..282 1378 99.3 Plus
CG9775-PA 421 CG9775-PA 111..392 1..282 1378 99.3 Plus
CG9915-PC 820 CG9915-PC 123..433 10..296 192 27.7 Plus
Blast to dper-all-translation-r1.3.fasta performed 2014-11-27 11:47:30
Subject Length Description Subject Range Query Range Score Percent Strand
Dper\GL21736-PA 473 GL21736-PA 118..389 1..250 222 54.5 Plus
Blast to dpse-all-translation-r3.2.fasta performed 2014-11-27 11:47:31
Subject Length Description Subject Range Query Range Score Percent Strand
Dpse\GA22027-PA 461 GA22027-PA 118..409 1..266 209 49.2 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2014-11-27 11:47:32
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM10692-PA 424 GM10692-PA 114..423 1..314 974 86.4 Plus
Blast to dsim-all-translation-r1.4.fasta performed 2014-11-27 11:47:33
Subject Length Description Subject Range Query Range Score Percent Strand
Dsim\GD19666-PA 413 GD19666-PA 111..412 1..314 959 82.7 Plus
Blast to dwil-all-translation-r1.3.fasta performed 2014-11-27 11:47:36
Subject Length Description Subject Range Query Range Score Percent Strand
Dwil\GK13464-PA 425 GK13464-PA 115..306 1..194 238 51.2 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2014-11-27 11:47:37
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE11129-PA 359 GE11129-PA 59..358 1..314 678 73.2 Plus
Dyak\GE25342-PA 413 GE25342-PA 111..402 1..307 614 75.6 Plus

GH14260.hyp Sequence

Translation from 1003 to 1950

> GH14260.hyp
MRADLVASGNAARNRRSGSSMRNVPATNGGGGGLRQRLGQRRPSVGGAAE
RVERRQRQQQQAPRGRSRSQSRSRHPQIQRVDRARSQSRGRSIGRSQSRN
RDRSAQGRVPVKQRLSVKHRLGVRTGQRNNQAKIPPQRRAPSQIRGVAGG
RVEKRRSAQISQKKGVSASIAGRQGRPRRRSVARNAASSSGAVNNSASAR
RSRSRNRAAAVAAAAIAATVQGRANPRQRRGRSAGAAKGKIIRNGKADKN
AKVKATNGVKSGPQQQVRRGRSRSRKPTGKSETSGQETNRTGSGNRHLKL
KIDIFLSLLSTYTLD*

GH14260.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 07:50:25
Subject Length Description Subject Range Query Range Score Percent Strand
CG9775-PD 315 CG9775-PD 1..315 1..315 1552 100 Plus
CG9775-PE 421 CG9775-PE 111..392 1..282 1378 99.3 Plus
CG9775-PC 421 CG9775-PC 111..392 1..282 1378 99.3 Plus
CG9775-PA 421 CG9775-PA 111..392 1..282 1378 99.3 Plus
CG9915-PC 820 CG9915-PC 123..433 10..296 192 27.7 Plus