Clone RE08418 Report

Search the DGRC for RE08418

Clone and Library Details

Library:RE
Tissue Source:Drosophila melanogaster embryo
Created by:Piero Carninci, RIKEN Genome Science Laboratory
Date Registered:2000-10-23
Comments:Average reported size from P Carninci is 2.3kb. Directionally cloned:5 end at XhoI, 3 end at BamHI
Original Plate Number:84
Well:18
Vector:pFlc-1
Associated Gene/Transcriptct-RB
Protein status:RE08418.pep: wuzgold
Preliminary Size:6796
Sequenced Size:2532

Associated Genes

Associations are from manual ordering of a clone or by a periodic analysis.
Gene Date Evidence
CG11387 2002-01-01 Sim4 clustering to Release 2
CG11387 2002-04-04 Blastp of sequenced clone
CG11387 2003-01-01 Sim4 clustering to Release 3
ct 2008-04-29 Release 5.5 accounting
ct 2008-08-15 Release 5.9 accounting
ct 2008-12-18 5.12 accounting

Clone Sequence Records

RE08418.complete Sequence

2532 bp (2532 high quality bases) assembled on 2002-04-04

GenBank Submission: AY095065

> RE08418.complete
CGTTGTTAATTGCTATTTGACGCGTTATATCGGCTACCGACGTATTCCGA
CCGACTTGGCTGTAGCTTCGAAATATTTTCTACCAACTTTGTGGTTATAC
CAATTGATTGGTAATACTCCCACTTCATTGCTCTCATTCAGAATTCCGCG
CAACCCTTGCCGAAAAGGAAGTGAACACACTCAAAGAGCAGCTATCCACC
GGCAATCCCGACAGCAACCTCAACAGCGAAAACAGCGATACAGCAGCAGC
GGCAGCAACAGCAGCAGCAGTTGCAGCAGTTGTTGCAGGAGCAACAGCAA
CAAACGACATCGAGGACGAGCAGCAGCAACAGTTGCAGCAGACGGCCAGC
GGCGGCATTTTGGAAAGCGACAGCGACAAGCTGCTGAACAGCTCCATTGT
TGCAGCGGCCATAACGCTGCAGCAGCAGAACGGCAGCAATCTGCTGGCCA
ACACAAATACGCCGTCGCCCTCGCCGCCGTTGCTCAGCGCCGAGCAGCAG
CAGCAGTTGCAGAGCAGTTTGCAACAGAGCGGCGGTGTTGGCGGCGCCTG
CCTCAATCCCAAGCTTTTCTTCAATCACGCCCAACAGATGATGATGATGG
AGGCGGCAGCCGCGGCAGCAGCGGCGGCATTGCAACAGCAGCAGCAACAG
CAATCACCACTCCATTCGCCGGCGAATGAAGTTGCGATTCCCACAGAACA
GCCAGCGGCAACAGTGGCAACAGGAGCCGCTGCTGCAGCAGCCGCAGCAG
CAACACCGATTGCAACTGGCAACGTCAAAAGCGGCAGCACCACCAGCAAC
GCCAATCACACCAACAGCAACAATAGTCACCAGGACGAGGAGGAGCTGGA
CGATGAGGAGGAGGACGAGGAGGAGGATGAGGACGAGGATGATGAGGAGG
AGAATGCCTCGATGCAATCGAATGCTGATGATATGGAGCTGGATGCGCAG
CAAGAAACCAGAACTGAGCCAAGTGCAACAACACAACAGCAGCATCAGCA
GCAGGATACAGAGGATCTTGAGGAGAACAAGGATGCGGGGGAGGCTAGTT
TAAATGTTAGCAATAATCACAATACAACCGATAGCAATAATAGTTGTAGT
CGAAAGAACAACAATGGCGGCAATGAAAGTGAGCAACATGTGGCCAGTTC
GGCGGAGGACGATGATTGCGCCAACAACAATACAAATACCAGCAATAACA
ACAATACCAGCAACACCGCCACCAGCAACACGAACAACAACAATAATAAT
AACAGCAGCAGCGGCAACAGCGAGAAGCGCAAGAAGAAGAACAATAACAA
CAACAACGGCCAGCCTGCTGTTCTATTAGCTGCCAAAGATAAAGAGGTAA
GTTTCAACTAACCGGAGGTTAAGTGGAAATAGTCGGTTGACAGGTGGTTA
AAAATAAAGTTAATTTCGGCTGAGCAAATATCTTACGCAAACCATGAAGC
TTACGAAAAATGCATCCCAGAAGTAAAGTTTAAGATGCATACAATTAAAT
ACTGTTAACCTAAGGTTGAAGCTTCCTGTTAAGTTAGTGCACATGTTTTA
AGTTTAAGTCTACCTTTTAACCCCTCGTCAGTCCAAAGTACTAGGGATTA
AACACAACCCTATTAACATAAAACTTCTCCGGTCTGCTCAGTGAGAAAAG
ACCAACTTTAAGTGACTTTTTAATTTAATAAACTGTAGCGGACTAAGGTC
GAATATCCTTAAAATTCACTCAAACCACCGACAGACAATTACCCGGCGCA
ATGAAATGTAAAACCGTTAAGATTAGACAAACGTCGCCGCCCACACCGGA
ATTTCGGAATGTGCAAGTGTGTATTTGGGGGGAAAAGCGGTTGGGAAAGG
ATGCCGTGGGCTGCCAAAAGGAGTGAAAGAAGCGTAAAAAAGTTAACCGG
AGTACCAAGGAGAGGAATTTCAACCGCAGACGACGACGCACGACTGACCG
ACCGCCGTCCCCTCAAACCAGTACGCACAATTGAGAAAACACTTGCACAA
ATAAACAAAACCCCCCATCACTTTTCCAACCACTCGGCCACTTTTCTTGT
AATTTTCTAGCCAAACAGAAAAAATGTTGCCCGAGTACGACGAAACCGAA
ACCGGGAAAAATAGAAAACAAAAAAAAAAAAGTATACAAGGCAAACAAAT
GAGCGGCGGGACTTTTGACTTCTTCTTTACACGCCCAAGAACAAGAAGAA
GCAGCAAAAAGGGACAAACTGGGTAAAAAATAAGCAAAAAAAAACTAACA
TACAGCCAGGGATTTCGAGCCTTTTCCCTGGGACAGCAATTTCAACCCAA
CATCAAGCCAAGGGAAAAAGTTAGAAGGAAACTTTTGCGGCAGGCAAACA
AGGACGGGGTCCCAAGGACAAGGACCAAAAACAGGGGGTGTAAAGTGATA
TCATTAAAATATTGACAAGACAATTTTTACGCCTACAAATTTGTTGAATG
CCTTTGTTTACACAGTACCAAATGGAAACGGAAGAAAGATGTCGCGTCAA
GAAATGGGATGAGATAGAAAAAAAAAAAAAAA

RE08418.complete Blast Records

Blast to MB8.fasta performed 2010-07-15 19:16:53
Subject Length Description Subject Range Query Range Score Percent Strand
ct-RB 2590 ct-RB 60..2590 2..2532 12625 99.9 Plus
ct.a 8411 ct.a 33..1269 110..1346 6185 100 Plus
ct-RC 8875 ct-RC 495..1730 111..1346 6180 100 Plus
Blast to d_melanogaster_OreR.fa performed 2014-11-27 09:15:36
Subject Length Description Subject Range Query Range Score Percent Strand
chrX 22417052 chrX 7537712..7540082 147..2517 11855 100 Plus
chrX 22417052 chrX 7524160..7524270 2..112 555 100 Plus
chrX 22417052 chrX 7524691..7524727 110..146 185 100 Plus
Blast to dmel-all-CDS-r6.02.fasta performed 2014-11-27 09:15:32
Subject Length Description Subject Range Query Range Score Percent Strand
ct-RC 7152 CG11387-PC 178..1413 111..1346 6180 100 Plus
ct-RE 6525 CG11387-PE 124..1323 147..1346 6000 100 Plus
ct-RA 6528 CG11387-PA 124..1323 147..1346 6000 100 Plus
Blast to dmel-all-all_noncoding-r5.12.fasta performed on 2010-04-22 20:30:50 has no hits.
Blast to dmel-all-transcript-r6.02.fasta performed 2014-11-27 09:15:29
Subject Length Description Subject Range Query Range Score Percent Strand
ct-RD 10732 CG11387-RD 7..1351 2..1346 6725 100 Plus
ct-RC 11062 CG11387-RC 446..1681 111..1346 6180 100 Plus
ct-RE 11035 CG11387-RE 392..1591 147..1346 6000 100 Plus
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 09:15:34
Subject Length Description Subject Range Query Range Score Percent Strand
ct-PC 2383 CG11387-PC 60..472 111..1349 864 99.8 Plus
ct-PE 2174 CG11387-PE 42..442 147..1349 797 99.8 Plus
ct-PA 2175 CG11387-PA 42..442 147..1349 797 99.8 Plus
ct-PD 2165 CG11387-PD 23..254 654..1349 405 99.6 Plus
Blast to na_all.dmel.RELEASE6 performed 2014-11-27 09:15:24
Subject Length Description Subject Range Query Range Score Percent Strand
X 23542271 X 7645780..7648165 147..2532 11900 99.9 Plus
X 23542271 X 7632228..7632338 2..112 555 100 Plus
X 23542271 X 7632759..7632795 110..146 185 100 Plus
Blast to na_arms.dmel.RELEASE6 performed 2011-12-12 20:46:46
Subject Length Description Subject Range Query Range Score Percent Strand
X 23527363 X 7653878..7656263 147..2532 11900 99.9 Plus
X 23527363 X 7640326..7640436 2..112 555 100 Plus
X 23527363 X 7640857..7640893 110..146 185 100 Plus
Blast to na_te.dros performed 2014-11-27 09:15:28
Subject Length Description Subject Range Query Range Score Percent Strand
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2290..2955 186..846 353 54.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2252..2895 161..833 330 56.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2306..2967 618..1310 325 55.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6680..7035 648..1000 312 57.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6724..6943 603..839 298 63.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6731..6929 633..834 290 63.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2254..2910 634..1310 288 54.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6751..6915 695..865 281 66.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2265..2856 696..1304 267 55.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..7002 709..1003 260 59.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6765..6898 697..826 255 68.9 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2308..2430 1185..1307 246 66.7 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2273..2867 746..1350 228 55.6 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6880 746..905 208 61.3 Plus
roo 9092 roo DM_ROO 9092bp 1048..1163 679..791 194 65.5 Plus
roo 9092 roo DM_ROO 9092bp 1088..1173 694..780 189 70.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6722..6855 770..904 177 60 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 2499..2663 607..759 176 62.3 Plus
roo 9092 roo DM_ROO 9092bp 1058..1157 1205..1310 165 65.1 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6720..6927 789..1006 163 57.3 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6757..7112 947..1304 162 54.5 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 6735..7200 319..822 155 56.2 Plus
Dvir\TART 8500 Dvir\TART TARTVIR 8500bp 1485..1614 672..799 122 60.2 Plus

RE08418.complete Sim4 Records

Sim4 to d_melanogaster_OreR.fa performed 2014-11-27 10:23:33 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
chrX 7538873..7540082 1308..2517 100   Plus
chrX 7538468..7538736 903..1171 100 == Plus
chrX 7538321..7538396 756..831 100 == Plus
chrX 7537877..7538267 312..702 87 == Plus
chrX 7537712..7537726 147..161 100 == Plus
chrX 7524692..7524727 111..146 100 -> Plus
chrX 7524158..7524268 1..110 99 -> Plus
Sim4 to dmel-all-CDS-r5.12.fasta performed 2010-07-28 17:01:56 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RC 178..1413 111..1346 100   Plus
Sim4 to dmel-all-CDS-r5.32.fasta performed 2011-03-16 18:15:11 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RC 178..1413 111..1346 100   Plus
Sim4 to dmel-all-CDS-r5.52.fasta performed 2013-08-04 10:06:18 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RC 178..1413 111..1346 100   Plus
Sim4 to dmel-all-CDS-r5.9.fasta performed 2008-07-21 18:57:14 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RC 178..1413 111..1346 100   Plus
Sim4 to dmel-all-CDS-r6.02.fasta performed 2014-11-27 10:23:33 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RC 178..1413 111..1346 100   Plus
Sim4 to dmel-all-transcript-r5.12.fasta performed 2010-07-28 17:01:56 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RB 1..2518 1..2517 99   Plus
Sim4 to dmel-all-transcript-r5.32.fasta performed 2011-03-16 18:15:11 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RB 1..2518 1..2517 99   Plus
Sim4 to dmel-all-transcript-r5.52.fasta performed 2013-08-04 10:06:18 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RD 5..1351 1..1346 99 == Plus
Sim4 to dmel-all-transcript-r5.9.fasta performed 2008-07-21 18:57:14 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RB 1..2518 1..2517 99   Plus
Sim4 to dmel-all-transcript-r6.02.fasta performed 2014-11-27 10:23:33 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
ct-RD 5..1351 1..1346 99 == Plus
Sim4 to na_all.dmel.RELEASE6 performed 2014-11-27 10:23:33 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
X 7645780..7648150 147..2517 100   Plus
X 7632760..7632795 111..146 100 -> Plus
X 7632226..7632336 1..110 99 -> Plus
Sim4 to na_arms.dmel.RELEASE5 performed 2013-08-04 10:06:18 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
arm_X 7539813..7542183 147..2517 100   Plus
arm_X 7526793..7526828 111..146 100 -> Plus
arm_X 7526259..7526369 1..110 99 -> Plus
Sim4 to na_arms.dmel.RELEASE6 performed 2011-12-09 15:29:42 Download gff for RE08418.complete
Subject Subject Range Query Range Percent Splice Strand
X 7653878..7656248 147..2517 100   Plus
X 7640858..7640893 111..146 100 -> Plus
X 7640324..7640434 1..110 99 -> Plus

RE08418.pep Sequence

Translation from 587 to 1360

> RE08418.pep
MMMMEAAAAAAAAALQQQQQQQSPLHSPANEVAIPTEQPAATVATGAAAA
AAAAATPIATGNVKSGSTTSNANHTNSNNSHQDEEELDDEEEDEEEDEDE
DDEEENASMQSNADDMELDAQQETRTEPSATTQQQHQQQDTEDLEENKDA
GEASLNVSNNHNTTDSNNSCSRKNNNGGNESEQHVASSAEDDDCANNNTN
TSNNNNTSNTATSNTNNNNNNNSSSGNSEKRKKKNNNNNNGQPAVLLAAK
DKEVSFN*

RE08418.pep Blast Records

Blast to dana-all-translation-r1.3.fasta performed 2014-11-27 22:18:59
Subject Length Description Subject Range Query Range Score Percent Strand
Dana\GF21154-PA 2273 GF21154-PA 218..446 69..254 205 47.7 Plus
Blast to dere-all-translation-r1.3.fasta performed 2014-11-27 22:19:11
Subject Length Description Subject Range Query Range Score Percent Strand
Dere\GG19652-PA 2414 GG19652-PA 221..464 23..254 576 78.3 Plus
Blast to dmel-all-translation-r6.02.fasta performed 2014-11-27 22:18:48
Subject Length Description Subject Range Query Range Score Percent Strand
ct-PD 2165 CG11387-PD 1..254 1..254 1300 99.6 Plus
ct-PE 2174 CG11387-PE 189..442 1..254 1300 99.6 Plus
ct-PA 2175 CG11387-PA 189..442 1..254 1300 99.6 Plus
ct-PC 2383 CG11387-PC 219..472 1..254 1300 99.6 Plus
Mur89F-PC 2158 CG4090-PC 271..487 18..252 205 20.4 Plus
Blast to dsec-all-translation-r1.3.fasta performed 2014-11-27 22:19:32
Subject Length Description Subject Range Query Range Score Percent Strand
Dsec\GM17531-PA 2349 GM17531-PA 211..436 23..254 646 93.5 Plus
Blast to dyak-all-translation-r1.3.fasta performed 2014-11-27 22:19:46
Subject Length Description Subject Range Query Range Score Percent Strand
Dyak\GE15727-PA 2261 GE15727-PA 301..474 106..254 405 74.9 Plus

RE08418.hyp Sequence

Translation from 587 to 1360

> RE08418.hyp
MMMMEAAAAAAAAALQQQQQQQSPLHSPANEVAIPTEQPAATVATGAAAA
AAAAATPIATGNVKSGSTTSNANHTNSNNSHQDEEELDDEEEDEEEDEDE
DDEEENASMQSNADDMELDAQQETRTEPSATTQQQHQQQDTEDLEENKDA
GEASLNVSNNHNTTDSNNSCSRKNNNGGNESEQHVASSAEDDDCANNNTN
TSNNNNTSNTATSNTNNNNNNNSSSGNSEKRKKKNNNNNNGQPAVLLAAK
DKEVSFN*

RE08418.hyp Blast Records

Blast to dmel-all-translation-r6.02.fasta performed 2014-11-28 15:57:08
Subject Length Description Subject Range Query Range Score Percent Strand
ct-PD 2165 CG11387-PD 1..254 1..254 1300 99.6 Plus
ct-PE 2174 CG11387-PE 189..442 1..254 1300 99.6 Plus
ct-PA 2175 CG11387-PA 189..442 1..254 1300 99.6 Plus
ct-PC 2383 CG11387-PC 219..472 1..254 1300 99.6 Plus
Mur89F-PC 2158 CG4090-PC 271..487 18..252 205 20.4 Plus