Expression Clone Sequence Generator


Predicted graphic map of plasmid for FMO02420:

NOTE: Generated plasmid sequence is only a prediction.
The expression clones have not been full-length sequenced
and the pDNR-Dual sequence is as provided by Clontech.

Predicted FASTA sequence of FMO02420 plasmid:

vector
loxP
insert
pDNR-Dual

>FMO02420, predicted.
CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGG
ACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTG
GACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAAC
GGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGC
GTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCG
GCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAAT
TCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCC
ATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGT
TGGGTCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCC
GGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATA
CGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGC
AACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGC
GGAAGTCAGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGT
CGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT
TATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGC
CAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA
TAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGA
GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCT
GTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCT
GTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG
CACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCG
TCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCA
CTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC
TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTAT
CTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTT
GATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAG
CAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTT
TTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTT
TGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGA
CAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTAT
TTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATA
CGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCC
ACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGG
CCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCG
CAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTG
GTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGA
TCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGT
TGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCAC
TGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACT
GGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAG
TTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAA
CTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCA
AGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACC
CAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAA
AAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCA
GGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATA
AACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
TAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCAC
GAGGCCCTTTCGTCTTCAAGAATTCACATTTGTACGAATTTTTTTTTTAT
CAAAAGTTCGAGTTTTTCACCAATTTCCTCATCAACCGAGCAAGGCAAAC
GGCTTTGAATAATATGGTGTTATATATACATATATCAAATCGCTGCTGAC
TGCGTGATTGATGGCCCCAAGATTACATATTATCGAATCAGGATTCAGAA
GGAGATCAATGTCAAATGCGGACAGGAACATGAAAGACGCCTGTTATGCG
CAATTAAAAATTTGGGTTTAATTGCTGTGGAAACTGTTGTTGGCGGCATC
TTAAGTTCCTGTTTAACAACATCAACTACTTATGTACGTAGAAGCGTTTA
AGCCATTTGCATACAGATGAGAACTGGCTTTTGTGCTAATCAGTCAAGAT
GACTCCGATGATGATGACTCATTACCTGACCAGTTTTCGCTGCTTTCTTT
TCAACAACTACTTGTATATGTATTGTATCCAATAGCAATACATTGAATTT
CCATGGTCTAGTCACGTATTATCATTTAATTGACACCAAGTCGTGTTATT
GTTGAGCTATCGAGTTCAGCTCAAACATTTCTTATTCCCATGAATAAGCC
GGCAAAAATATGCAATCTATGAAAGTTAATATAAGCAAACCTTACTTTGA
CTCAATACCAATGCACTTTGTGTCGATAGGTTCACGCAATTGAGGCGATT
ATTCCGATAACCCAAGCGATTGACTGTTCCCGTTTCGATTCCAATTGAAA
TTTGGAAATGTACAATAGTTTTGCTATATGCTGTCAAGTACGCTCTTATC
TTCTCTGGGTTTTCTTCAGAGTTTCGAAACGCTTCTTCTTTTTTTTGTTT
TTTTTTTTTTGGAATCTCGTATTTTGGAAGGGGCTCCCCTCTGGAATTTG
TTACACTGTCGTTATCATTGCGAACAAGCGGCCCGAAGCTATCAGCGACT
TTAACATTTACAATGCACTTTTTTACGACCAATTAAATGTACATTTTCCT
TTCTTCGCCCGTTGATAAGCGAACGCGATGTGGCGCAGGCAATGTGTTGC
TCTTGCGACACAAACGCAATCAAAATGGATTCAATTTCGCTTTTTCCCAG
TGAAACGAAGAACGAACCGACCATCATGATATGCTCCTCTGCATGTTGCG
TATTGAATCAATGACAATTTCAATTAAGCCGCCCGTTCGTCATGCGTTTT
CGTGCGCTTCGAAATGCTGATAACGCTGCTGTCCTCCAACTGCTTTGCAT
GTGGACACAATTCCATTTATTTAATTCTTTTATTTGGATCGGTTAAATTA
AAAAGCGCCTTGTTACGCATTTAACGTTGTTTCCGGTGCGTGGTGGTTTC
ATGCTTCTGGGAACGGCAAATGGGTTTAGGATTGGGAACCCCTCATCATC
TGTTGGAATATACTATTCAACCTACAAAAGTAACGTTAAACAACACTACT
TTATATTTGATATGAATGGCCACACCTTTTATGCCATAAAACATATTGTA
AGAGAATACCACTCTTTTTATTCCTTCTTTCCTTCTTGTACGTTTTTTGC
TGTAAGTAGGTCGTGGTGCTGGTGTTGCAGTTGAAATAACTTAAAATATA
AATCATAAAACTCAAACATAAACTTGACTATTTATTTATTTATTAAGAAA
GGAAATATAAATTATAAATTACAACAGGTTATGGACCTGCAGCCAAGCTT
GGCGCTCGTCCGGGGGCAATGAGATATGAAAAAGCCTGAACTCACCGCGA
CGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTG
ATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGG
AGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACA
AAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCG
GAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTC
CCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGC
CCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCC
GATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGG
TCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATG
TGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCG
CAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCG
GCACCTCGTGCACGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATG
GCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCC
CAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTAT
GGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGAT
CGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTAT
CAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCG
ATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAA
TCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTC
GCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATA
GAGTAGATGCCGACCGAACAAGAGCTGATTTCGAGAACGCCTCAGCCAGC
AACTCGCGCGAGCCTAGCAAGGCAAATGCGAGAGAACGGCCTTACGCTTG
GTGGCACAGTTCTCGTCCACAGTTCGCTAAGCTCGCTCGGCTGGGTCGCG
GGAGGGCCGGTCGCAGTGATTCAGGCCCTTCTGGATTGTGTTGGTCCCCA
GGGCACGATTGTCATGCCCACGCACTCGGGTGATCTGACTGATCCCGCAG
ATTGGAGATCGCCGCCCGTGCCTGCCGATTGGGTGCAGATCTTTGTGAAG
GAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGAT
TTAAAGCTCTAAGGTAAATATAAAATTTTTAAGTGTATAATGTGTTAAAC
TACTGATTCTAATTGTTTGTGTATTTTAGATTCCAACCTATGGAACTGAT
GAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTC
AGAAGAAATGCCATCTAGTGATGATGAGGCTACTGCTGACTCTCAACATT
CTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAAGGACTTTCCT
TCAGAATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCT
TGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACA
AGAAAATTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGT
TATAATCATAACATACTGTTTTTTCTTACTCCACACAGGCATAGAGTGTC
TGCTATTAATAACTATGCTCAAAAATTGTGTACCTTTAGCTTTTTAATTT
GTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTTGACTAGAGAT
CATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTT
GTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCAT
CACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTT
TGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCAATTCGTTGCAG
GACAGGATGTGGTGCCCGATGTGACTAGCTCTTTGCTGCAGGCCGTCCTA
TCCTCTGGTTCCGATAAGAGACCCAGAACTCCGGCCCCCCACCGCCCACC
GCCACCCCCATACATATGTGGTACGCAAGTAAGAGTGCCTGCGCATGCCC
CATGTGCCCCACCAAGAGCTTTGCATCCCATACAAGTCCCCAAAGTGGAG
AACCGAACCAATTCTTCGCGGGCAGAACAAAAGCTTCTGCACACGTCTCC
ACTCGAATTTGGAGCCGGCCGGCGTGTGCAAAAGAGGTGAATCGAACGAA
AGACCCGTGTGTAAAGCCGCGTTTCCAAAATGTATAAAACCGAGAGCATC
TGGCCAATGTGCATCAGTTGTGGTCAGCAGCAAAATCAAGTGAATCATCT
CAGTGCAACTAAAGGGGGGATCTCGAGGGATCC
ATAACTTCGTATAGCAT
ACATTATACGAAGTTAT
CAGTCGACATGCTGCTCTCAATGCAAATGTGGC
GCTCTCTGTGGCTGGCGGCCCTATTCTGCGGATTAGCCCAGGCCAAAGGT
TCCCACAAGGTGCACTGTTCGGAGGATCAGATGAGGGTTGACATCGGACT
GCCGGATGCGGAGTCAAAGGATCAGAGTGCTCCTCAGATCTATTTGGAGG
GATTGAAGGGATATCCGGATGAACGATGCCAGCCGCAAATCGATGGATCC
CTGGCCGTTTTTCGGCTTTCACTCAGCGATTTTTACGAGTGCGGAGTAAC
TCGAATGGTCAACCAGCTAACGGGCAAGAAGGTGTATTACCATAAAATCA
TCATCGAGTCAACCAGCGGCAAGGAGATCGTCAGCGTTAAGTGCATCACC
ACCGCCAGTCCCGCCTATAATGTGATGATGAATGCCACCACCGGGTCCAG
TTCCACGTCCACTTCCAGCGGCGGCATCCACGGCCTGGTCAAGCGGGATG
TGCTGCCGGCGGGATTCCAGGAACCCGAGGATCTGGAGATCACCACATCG
CTGACCAAGCGGGCCCCGGAGCCACGACTCTCAATTGGCGTTAGCCAGGA
TGGTCAGAAGTTCACCAGGGATTTGACTGTCAAGTCGGGCACACCTTTGA
CAATGGAAATCAATCTGGATGAGGACTCTGCACCTGTTTATGGTCTGGGT
GTCAACTATTTGGATGTGACGGATACGCATACGTCATCGGAAACGTTGAT
CTTCAAGGGCTGCACAGTGGATCCCTATCTCTTCGAGAACTTCAACACCA
TTGATGGCGACATTTTGAGTGCCAAGTTCAAGGCCTTCAAGTTCCCCGAC
TCGTCGTACGTGCAATTCCGTGCCACGGTCAACGTGTGTTTGGACAAGTG
CCTCGGCACCCAGTGCTCCAACAACCAGGTGGGCTTCGGTCGACGCAAGC
GAGAGATCAGCTCAGCGAACAAGGTCTACGAGATCTCGCTGGCCATGTTC
CTGCAGGTTCAGGATATCGAGGGTGTCAACAAGAATGAGGTCCTGCAGCT
GGAGGAGAAGCTTAGGGAGCTGAAGCTGGCCAACCAGCGCTTGGCCAGGA
ATAGTCGCGGCAACTTTGCCATGGAGCAGACGCCCGCCAGTGCTCAGCCC
GCCTTTGTCGTGGACGAGCGGGAGCTGGGACATCTCAGTGCCGGATCGGG
AGCCGCATCGAACGGCCTGTCGCTGGCTCTCTGGACGATTCTGGGGGCAT
GGAGTTGGCGGCTGATGGC
AAGCTTTCTAGACCATTCGTTTGGCGCGCGG
GCCCAGGTGAGTGGTCATAATCATAATCATAATCATAATCATAATCACAA
CTAGCCTAGGAGATCCTGGTCATGACTAGTGCTTGGATTCTCACCAATAA
AAAACGCCCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCT
GAGGTCATTACTGGATCTATCAACAGGAGTCCAAGCGAGCTCGATATCAA
ATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGC
ATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGC
CAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGA
AAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTG
GTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAA
CCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCG
AATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGC
GATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAAC
ACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGAAATTCCG
GATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAAC
TTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTG
AACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAAT
GTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATT
TTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAGATCC
ATAACTTCGTA
TAGCATACATTATACGAAGTTAT
AGATCCAATATTATTGAAGCATTTATC
AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAAT
AAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT
GGATCTCGAGCTCAAGCTTCGAATTCAGGGTTTCCTTGACAATATCATAC
TTATCCTGTCCCTTTTTTTTCCACAGCTACCGGTCGCGACTAGTGACTAC
AAAGACGATGACGACAAGGTCAAACTTTACCCATACGATGTTCCAGATTA
CGCTGCTGCTTAGACTAGTTCTAGTCGACCATGAAGATCAAGATCATTGC
CCCGCCAGAGCGCAAGTACTCTGTCTGGATCGGTGGCTCCATCCTGGCTT
CGCTGTCCACCTTCCAGCAGATGTGGATCTCCAAGCAGGAGTACGACGAG
TCCGGCCCCTCCATTGTGCACCGCAAGTGCTTCTAAGAAGGATCGCTTGT
CTGGGCAAGAGGATCAGGATCGGGATGGTCTTGATTCTGCTGGAGGAGGA
GGAGGAGAAGTCGAGGAAGCAGCAGCGAAAGTGCAAGTGCGAGTGGTGGA
AGTTTGGAGTGCAGCACAACAAAATCAACAACAACACCAACTACAAGATG
AAAAGAGCGGAACCACCTGCACACCATCATCACTATCATCATCGTTTTGG
GCGCATGTTGTGTGGTTCCAGCGTATTAATATAATTAATTTATTCCACAT
GAGATATGATATGATATACTATGTATTTTTTGTTTTTTTTTTATTTGTAA
ACCTTTAATATAACAAGAACTACAAAAAATGAAAATGAGCGAAAATGCAT
ATTCTGCCATTCCACACACACACCAACAACACCCAACACACGCACACCCA
CAAGCTTACACACACACATTCGCGGCATGACAAGGACATCAAGATAAAGA
AGAACTTAAAGAAGATATTTCCCAAAGCGCAAAAAGAACACACACACATT
GCAAAACACAAACAACACACTAGCGTTTTGTACAATTCGTCAGCAACCTT
ATGTATTATTTTTTAATTATGATGTAATTATAAACAAAGTGAAACAAAAA
TATGAAAACAAAAAGGAAAATCAAATCTGTCTTCTCTTTCTCCCGCTCTC
CTCGCTCTCTGCTGCTAACCTCGCCCTCTCCTCTCTCATCTTTTTGTCTG
TCTCTCTTCCACATTTTTGCCGGCCGGCAAAATAATAACCCACACACACT
CACACTTGGCTGCAGTTTCGCGTGCGATATTCACACACATTCAAGCATAC
AAGCATACATACATATGTATTTTTTTTTTATTTGTACACTTTTCTAATTG
CATGCGTATCGATTGATAAGTTTACGCCTGAAAATGTTAATTAAAATGTG
AAAATGCAACTGAAAAACTGATGAAATGAAACAACAACAAGCGAACAATT
TGCTACATGTGTATTGTCTAACAACCGTTACTGCAACGGTTGCTTCGGAA
AAGGGTGAAGAGGAAGAGGGCACGAGGTCGACTAGAGCGGCCGCCGACGC
GAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATC
GGGATG